Cindy Boer

Microbiome Composition, Joint Pain and Inflammation | 245 5.2 qPCR replication of 16S rRNA-sequencing results To validate the 16S rRNA-sequencing results we determined the absolute quantitative amount of Streptococcus spp. using qPCR. We determined the amount of Streptococcus spp. for each fecal DNA sample using the BactoReal qPCR assay (Ingenetix GmbH, Vien- na, Austria) based on the Streptococcus 23S rRNA gene. A standard curve of a Plasmid standard containing the 23S rRNA gene (Ingenetix GmbH, Vienna, Austria) was includ- ed in each plate to calculate the amount of Streptococcus spp. present in each sample. Each sample was run in duplo in a 384-wells PCR plate containing 40ng fecal DNA, 1x primers and probes (Ingenetix GmbH, Vienna, Austria), 1x TaqMan Gene Expression Master Mix (Life technologies) in a total volume of 5µl. The qPCR was performed in a QuantStudio 7 Flex (ThermoFisher) with an initial denaturation at 95 °C for 10min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. To normalize the amount of Streptococcus spp. for the total amount of bacteria in each sample, a 16S qPCR was performed (U16SRT-F: ACTCCTACGGGAGGCAGCAGT and U16SRT-R: TATTACCGCGGCT- GCTGGC, Supplementary Table 9)[57]. A standard curve of a Bacterial DNA Standard (Zymo Research) sample was included in each PCR plate to calculate the total amount of bacteria. Each sample was run in duplo in a 384-well plate containing 200pg fecal DNA, 200pmol forward and reverse primers, 1x SYBR Fast ABI PrismTM Mastermix (Kapa- Biosystems) in a total volume of 5μl. The qPCR was performed in a QuantStudio 7 Flex (ThermoFisher) with an initial denaturation at 95 °C for 3min, followed by 40 cycles of 95 °C for 5 s and 60 °C for 20 s. Absolute abundancies were calculated from the standard curves. We adjusted the total absolute abundancy of bacteria for the average number of 16S copies (4.2 copies per bacteria[58]). We adjusted the absolute abundance of Streptococcus spp. for the average number of 23S rRNA gene copies in Streptococcus spp. (3.36 copies per Streptococcus spp., based on S. pneumoniae, S. thermophiles, S. pyogens, S. parasanguinis, S. dysgalactiae, S. salivarius, S. suis, S. mutans, and S. agalac- tiae). We normalized the absolute abundance of Streptococcus spp. by calculating the log transformed value of the number of Streptococcus spp. per 1000 bacteria in each sample: log(Streptococcusabsoluteabundancetotalabundanceofbacteria/1000) Statistical analysis Statistical analyses were performed in R: A Language and Environment for Statistical Computing[59]. Inter-individual microbial composition (β-diversity) was calculated using the Aitchison distance calculated from the CLR (centered log-ratio) normalized data. CLR normalization was calculated on the counts of the directly taxonomic classi- fied reads. The full dataset, including unknown and unclassified taxonomies was used for the CLR. To all read counts 1 was added to cope with the overabundance of zero’s in the data, for CLR[33]. Subsequent statistical analysis was done through permutation