Femke Mathot

Chapter 4 64 parameters: an initial step at 95oC for 15 min followed by 50 cycles of 95oC for 20s, 60oC for 35s and 72Co for 35s. All mRNA levels were calculated using the 2-ΔΔCT method and expressed relative to GAPDH as housekeeping gene. Statistical analysis The results of qPCR measurements of both undifferentiated and differentiated MSCs over time were analyzed per gene using a 2-factor Analysis Of Variance (ANOVA) with repeated measures on one factor. Post-hocmultiple comparisons were evaluatedby theMannWhitney-U test with Bonferroni correction. Data are expressed as the mean difference plus or minus the standard error of the mean (SEM). Significance was set at a= 0.05. The interaction between the cell-types and the ECM was estimated by comparing the baseline gene-expression of both cell types (Tc) to the gene-expression of both groups immediately after seeding onto the processed nerve graft (T0). Relative differences in gene expression between undifferentiated and differentiated MSCs were also calculated. Table 2. mRNA primer sequences. Gene ID Biology Forward primer Reverse primer GAPDH Household gene TACCAGGGCTGCCTTCTCTTG GGATCTCGCTCCTGGAAGATG CYCA Household gene AGGATTCATGTGCCAGGGTG CTCAGTCTTGGCAGTGCAGA PGK1 Household gene CGTGATGAGGGTGGACTTCA GCAGCAACTGGCTCTAAGGA NGF Neurotropic marker CACTCTGAGGTGCATAGCGT CTATTGGTTCAGCAGGGGCA GDNF Neurotropic marker CTGACCAGTGACTCCAATATGC TTAAGACGCACCCCCGATTT PTN Neurotropic marker GCCGAGTGCAAACAAACCAT TGATTCCGCTTGAGGCTTGG GAP43 Neurotropic marker GATAACTCGCCGTCCTCCAA CTACAGCTTCTTTCTCCTCCTCA PMP22 Neurotropic marker GTCTGGTCTGCTGTGAGCAT GCCATTGGCTGACGATGGTG VEGF Angiogenic marker AGAAAGCCCATGAAGTGGTGA GCTGGCTTTGGTGAGGTTTG CD31 Angiogenic marker TTGTGACCAGTCTCCGAAGC TGGCTGTTGGTTTCCACACT COL1A1 ECM protein AAGTCTCAAGATGGTGGCCG TCGATCCAGTACTCTCCGCT COL3A1 ECM protein CCCGGCAACAATGGTAATCC GACCTCGTGCTCCAGTTAGC FBLN1 ECM protein GCAGACACCTTTCGCCAAGA CGTGACAGCCCTCAGAAAGA LAMB2 ECM protein AGTACCCACACGGATGGAGTG CTCGAGAACAGCCAGGTACA CASP3 Cell apoptosis protein GGAGCTTGGAACGCGAAGAA ACACAAGCCCATTTCAGGGT CCNB2 Cell cycle component ACCAGTGCAGATGGAGACAC GACTGCAAAGCCTCAAGCTG