Dolph Houben

101 Neoangiogenensis, transplant viability and molecular analysis of bone VCA 5 quantified using the 2 (- ΔΔ CT) method [14] . Primer sequences and genes of interest are given in table 1 (ThermoScientific, Invitrogen, Wilmington, DE). Table 1: Primer sequence and name for each gene of interest Gene Full name Sequence Neo-angiogenesis VEGF-A Vascular endothelial growth factor 5’-3’: CTACCTCCACCATGCCAAGT 3’-5’: ACACTCCAGACCTTCGTCGT EGFL-6 Epidermal growth factor-like 6 5’-3’: AGATGAACGGTGGAAGATGG 3’-5’: CAGATAAAGGGCCATCTGGA HIF-1A Hypoxia-inducible factor-1alpha 5’-3’: TTACAGCAGCCAGATGATCG 3’-5’: TGGTCAGCTGTGGTAATCCA CD-34 Cluster differntiation-34 5’-3’: GGAAACCACACCAGATGCTT 3’-5’: AGGTCTGAGGCTGGACAGAA Bone formation CTSK Cathepsin K 5’-3’: CGTGGCATTGACTCAGAAGA 3’-5’: CCACAGAGACAGGTCCCACT RANKL Receptor Activator NF-kB Ligand 5’-3’: TCACCAAAACCAGCATCAAA 3’-5’: AAGTACGTGGCGTCTTGGTC OPG The Tumor Necrosis Factor superfamily- 11B (Osteoprotegerin) 5’-3’: ATATCGGGCACATGAACCTC 3’-5’: GGGGAAGTGGTACGTCTTGA BGLAP Bone Gamma-Carboxyglutamate Protein (Osteocalcin) 5’-3’:TCACACTGCTTGCCCTACTG 3’-5’:GGGTTGAGCTCACACACCTC Housekeeper GAPDH Glyceraldehyde 3-phosphate dehydrogenase 5’-3’: ACACTCACTCTTCTACCTTTG 3’-5’: CAAATTCATTGTCGTACCAG Statistics Since the data was collected from a low sample size (N=14), a non-parametrical test (Wilcoxon rank sum test) was used to detect a difference between the two groups (allotransplants with Patent AV-bundle versus allotransplants with ligated AV-bundle). For the same reasons, a non-parametric (Wilcoxon signed-rank test) test was used to detect a difference between the operated and contra-lateral tibia. All statistical tests were two-sided and differences were considered significant for p-values of < 0.05. Statistical analyses were performed using the statistical program JMP Pro 13.0.0 (SAS Institute Inc.) and GraphPad Prism 5.03 for illustrations (GraphPad Software, La Jolla, CA). Power calculations were made by the division of biostatistics at Mayo Clinic using nQuery Advisor for outcomes of interest, including capillary density and osteocyte viability. This study was powered for an estimate of 80%, with significance level set at 0.05, to detect a minimal difference between the groups, based upon our previous studies of structural orthotopic bone allografts in rats and rabbits [Refs]. Due to complications during allotransplant harvest, only five animals in each group were included for gene analyses. Statistical analysis was supported by the Center for Translational Sciences Activities (CTSA) at Mayo Clinic.