Dolph Houben

122 CHAPTER 6 Real-time qPCR was performed using the iQ SYBR green Supermix (2X) and the CFX384 real- time detection system (Bio-Rad, Hercules, CA.) with 12µL reaction. Each PCR reaction consisted of 6.25 SYBR green, 0.25 µL primers (20µm/ml), 3.0µL H 2 O and 2.5µL sample. All samples were run in triplicate. Real-time PCR was followed by melt curve analyses with the following conditions: 15min denaturation at 95⁰C for one cycle, the 20s of denaturation at 95⁰C, 35s of annealing and extension at 72⁰C for 51 cycles followed by generation of a melting curve. Melt curves were performed from 60 ⁰C to 95⁰C with an increment of 0.5⁰C. Real-time PCR products of samples and amplicons were run on a 2% agarose gel stained with ethidium bromide to confirm the proper size (Fig. 3). In addition, the PCR products were sent in for Sanger sequencing, and sequences lined up with the genes of interest. Table 1: Primer sequences [ 16, 17] Gene (ID) Full name Sequence SRY (407740) Sex-determining region Y protein 5’-3’: AGTCAGTCACAGCCCAGTAA 3’-5’: GGAAAATAAATGTGAGAAAG SRY-e (407740) Sex-determining region Y protein with exon 5’-3’: TGGCGTAATTTGCGTCTTACT 3’-5’: TCACCCTTCTGAACCAGCTT RPL-4 (100038029) Ribosomal protein L4 5’-3’: AACGCTTTCATTGTGTGGTCTC 3’-5’: CTCTGTGCCTCCTCGAAGAATG Figure 3: Electrophoresis 2% agarose gel confirming the right PCR product size for the different genes of interest.