Dolph Houben

140 CHAPTER 7 Table 1: primer sequence and name for each gene of interest Gene Full name Sequence Immunology markers TNF Tumor Necrosis Factor alpha 5’-3’:CCACCAACGTTTTCCTCACT 3’-5’: CCAAAATAGACCTGCCCAGA IL2 Inter Leukine 2 5’-3’: CAAACGGTGCACCTACTTCA 3’-5’: CCTGCTTGGGCATGTAAAAT IL6 Inter Leukine 6 5’-3’: ATGGCAGAAAAAGACGGATG 3’-5’: GTGGTGGCTTTGTCTGGATT IL8 Inter Leukine 8 5’-3’: TGGCAGTTTTCCTGCTTTCT 3’-5’: CAGTGGGGTCCACTCTCAAT IFNG Interferon gamma 5’-3’: TTCAGCTTTGCGTGACTTTG 3’-5’: TCCTTTGAATGGCCTGGTTA CD4 Cluster Differentiation 4 5’-3’: GCTGGGGAACCAGAGTATGA 3’-5’: AGAACCCAGCGAGAAACAGA CD8a Cluster Differentiation 8a 5’-3’: TGCACTCCAACACACTGACA 3’-5’: TGTCATTGGCCTTGTAACCA CD28 Cluster differentiation 28 5’-3’:TCGGCCTCCTGAGTCTTCTA 3’-5’:AGTCACGTGCTGGTGCATAG Housekeeper GAPDH Glyceraldehyde 3-phosphate dehydrogenase 5’-3’: ACACTCACTCTTCTACCTTTG 3’-5’: CAAATTCATTGTCGTACCAG Statistical analyses Since the data was collected from a low sample size (N=14), a non-parametrical test (Wilcoxon rank sum test) was used to detect a difference between the two groups (allotransplants with Patent AV bundle versus allotransplants with ligated AV bundle) as well as differences within each animal. All statistical tests were two-sided and differences were considered significant for p-values of < 0.05. Statistical analyses were performed using JMP Pro 13.0.0 (SAS Institute Inc.) and GraphPad Prism 5.03 for illustrations (GraphPad Software, La Jolla, CA). Statistical analysis was supported by the Center for Translational Sciences Activities (CTSA) at our institution. Results All animals were fully weight-bearing at an average of 4 days after transplantation and gained an average of 20.0kg in weight during the survival period. During the 2 weeks of initial immunosuppression, drug levels remained in therapeutic range for all animals. In the first 2-4 weeks, six animals developed seromas in the inguinal area, which resolved spontaneously. Four animals were excluded from analyses for either deep infection, unrecognized pregnancy, uncontrollable seizures or breach of bone harvest technique. This left 5 animals in each group for analysis.