Mark Wefers Bettink

Chapter 7 134 Eppendorf tube followed by another centrifuge step at 16.000xg for 15 minutes at 4°C. A final volume of 170 µl of the supernatant was transferred to a new Eppendorf tube and was used for DNA isolation. 30 µl of PBS, 20 µl Proteinase K and 200 µl AL buffer (from DNA isolation kit) were added to the 170 µl supernatant. After mixing, the samples were incubated at 56°C for 15 min. After incubation 200 µl of absolute ethanol was added and mixed using vortex. The samples were then transferred to a DNeasy isolation column from the kit and the kit protocol was followed. In the final step the DNA was eluted in 200 µl of eluent (AE buffer). qPCR To analyse the levels of mitoDNA in the isolated DNA samples from plasma, the following primers were used: human NADH Dehydrogenase 1 (mtND1), forward primer: 5’-ATACCCATGGCCAACCTCCT-3’, reversed primer: 5’-GGGCCTTTGCGTAGTTGTAT-3’. As a control for nuclear DNA the following primers were used: human β -globin, forward primer 5’- GTGCATCTGACTCCTGAGGAGA -3’, reversed primer 5’-CCTTGATACCAACCTGCCCAG-3’. A final primer concentration of 400 nM was used. To quantify the levels of mitoDNA (mtND1) a gBlock gene fragment (synthetic dsDNA fragment of the mtND1 gene, made by IDT-DNA) was used as positive control. The gBlock gene fragments are provided dry and must be resuspended in IDTE to a final concentration of 10 ng/µl according to company instructions. The copy number/µl was calculated using the following formula: C x M x (1x10-15 mol/fmol) x Avogrado’s number = copynumber/µl Where C = current concentration in ng/µl (=10 ng/µl ), M= molecular weight in fmol/ng (= 5,22 according to datasheet delivered with the gBlock), Avogrado’s number = 6,022 x 10 23 . The calculated copy number/µl in the stock solution is 3,14 x 10 10 copies/µl . A 10 fold dilution series from 3,14 x 10 5 to 3.14 x 10 0 was used as a standard. To perform the qPCR analysis the SensiMix SYBR & Fluorescein kit, Bioline #QT615-05 (Meridian bioscience inc, Cincinnati, Ohio, USA) was used in combination with the Bio-Rad CFX96 real time system. The qPCR program was as follows: To start 2 min 50°C and 10 min 95°C, then 40 cycles of 15 sec 95°C & 1 min 58 °C. At the end a melting curve analysis was performed to check amplification specificity. The data was analyzed using the qPCR software (Bio-Rad CFX manager 3.1 All samples and standards were measured in duplicates and a no template control