Joris van Dongen

110 Chapter 5 Table 1. Primers used for real-time PCR and In Vitro Inflammation Assay. Target gene Primers 18S Forward GTAACCCGTTGAACCCCATT Reversed CCATCCAATCGGTAGTAGCG KDM5D Forward TAACACACACCCGTTTGACAA Reversed GCTGCTGAACTTTGAAGGCTG IL-1b Forward 5’-GCTGAGGAAGATGCTGGTTC-3’ Reversed 5’-TCCATATCCTGTCCCTGGAG-3’ COX2 Forward 5’-GCCCGACTCCCTTGGGTGTC-3’ Reversed 5’-TTGGTGAAAGCTGGCCCTCGC-3’ KDM5D: lysine demethylase 5D; IL-1b: Interleukin 1 beta; COX2: prostaglandin-endoperoxide synthase 2 (PTGS2) Statistical analysis Descriptive statistics were used to evaluate the number of cells in tSVF, cell composition of tSVF, colony forming units as well as the number of cells after co-culture of chondrocytes and tSVF-derived cells, the amount of sGAG and the expression of IL-1 β and COX2. Data were expressed as mean with standard deviation. A two-tailed paired t-test was performed to analyze the number of cells after co-culture of chondrocytes and tSVF-derived cells. A two-tailed unpaired t test was performed to analyze the amount of sGAG and the expression of IL-1 β and COX2. All data was analyzed using Graphpad Prism, version 5.01 (Graph Pad Software Inc., Los Angeles). RESULTS Characterization of tSVF Enzymatic isolation of tSVF yielded a mean number of viable cells of 2.67 × 10 6 ± 4.63 × 10 5 per 1 ml (Fig. 1). Composition of tSVF contained a mean number of 48.87% ± 17.59% of ASCs (CD45-; CD90+; CD105+), 39.55% ± 32.38% of endothelial cells (CD31+; CD34+), 3.42% ± 3.18% of leukocytes (CD45+; CD34-), 0.23% ± 0.19% of pericytes (CD34+/-; CD31-; CD146+), 0.32% ± 0.39% of hematopoietic stem cell- like cells (CD45+; CD34+) and 5.95% ± 8.54% of supra-adventitial cells (CD34bright; CD31-, CD146-) (Table 2).