Zsa Zsa Weerts

Chapter 5 108 Colonic biopsies (right-sided proximal and sigmoid colon) were collected from IBS patients and controls in both Maastricht and London during routine colonoscopy examination under conscious sedation using midazolam and fentanyl or pethidine, from macroscopically normal mucosa. A standard biopsy forceps with a diameter of 2.8 mm (Boston Scientific) was used to obtain mucosal biopsies. Full thickness tissue and biopsies collected in London were placed in cold 4% paraformaldehyde, and fixed for 16-18h or 2h at 4ºC, respectively. Biopsies collected in Maastricht were directly placed in Eppendorf tubes and snap frozen in liquid nitrogen and stored at -80 o C. Biopsy samples collected in Maastricht that were used for IHC were thawed and subsequently fixed in 2% PFA for 2h. RNA isolation and quantitative PCR Total RNA was isolated from the frozen biopsies using TRIzol reagent (Invitrogen, Carlsbad, USA) and purified with the RNeasy Plus Mini Kit (Qiagen, the Netherlands). Quantity and purity of the RNA samples was determined using a Nanodrop spectrophotometer (NanoDrop Technologies, Wilmington, USA). A concentration from 5 µg/µl total RNA was used. Finally, the cDNA was diluted 100× with RNAse free water and amplified: each reaction contained 12.5 µl iQ Sybr Green Supermix, 1µl of 10 µM gene-specific forward and reverse primers, 4 µl diluted cDNA template and 5.5 µl sterile water. Reactions were run on the CFX 96 Real-time qPCR Detection System (Bio-Rad). PCR conditions used were 3 min at 95°C, followed by 40 amplification cycles of 10 sec at 95°C and 45 sec at 60°C. Data were expressed as normalized expression ratios. Primers: GAPDH1 F: TGCACCACCAACTGCTTAGC; R: GGCATGGACTGTGGTCATGAG; TRPM8 F: GCTGTACAAAGCCTTCAGCAC, R: CTCATCACTGGCAAGGTCCA. Quantitative PCR experiments were performed in 30 sigmoid biopsies and 24 right-sided colon biopsies from 30 IBS patients and 23 healthy controls (all obtained from the Maastricht cohort). Immunofluorescent staining and tissue analysis Prior to analyses, biopsy samples were cryoprotected in 30% sucrose overnight, followed by an incubation in 50% sucrose and 50% OCT cryostat sectioning medium, and finally embedded in a cryomold with OCT. Tissues were stained as described. 13 In brief, cryoprotected tissues were cut into 10 μm sections and incubated with Trident Universal Protein Blocking Reagent (Gene Tex, GTX30963) for 2 h before primary