Supplemental file 2. Staphylococcus aureus PCR DNA was isolated from freshly grown samples using the MagNA Pure 96 platform in combination with the MagNA Pure 96 DNA and Viral Nucleic Acid Small Volume Kit (Roche Diagnostics, Almere, the Netherlands) as recommended by the manufacturer. Prior to extraction, samples were spiked with Phocine Herpesvirus (PhHV) (Viroscience, Erasmus University Medical Center MC, Rotterdam, the Netherlands) as an internal process control. A multiplex real-time PCR was performed on the LightCycler 480 platform (Roche Diagnostics) with maximum heating and cooling settings. Amplification reactions (20µL) consisted of 5 µL DNA, primers and probes (sequences and concentrations according to Table 1) in 1x LightCycler 480 Probes Master (Roche Diagnostics). Cycling parameters involved an initial denaturation for 5 min at 95°C followed by 50 cycles of 95°C for 5s and 60°C for 30s after which the samples were cooled down. Supplementary table 1. Primers and probes used in the PCR screening assay Target Conc. (µM) (reporter label)-sequence-(quencher) nucA (S. aureus) Forward 0.5 TGCTGATGGAAAAATGGTAAAC Reverse 0.5 AAAWGTTGTTCATGTGTATTGTTAGG Probe 0.1 (Cy5)-TCGTCAAGGCTTGGCTAAAGTTGCT-(BHQ2) mecA Forward 0.5 AACTTAATTGGCAAATCCGGTA Reverse 0.5 AAACCACCCAATTTGTCTGC Probe 0.1 (FAM)- CTGCAGAACTCAAAATGAAACAAGGAGAAA- (EDQ) mecC Forward 0.5 CGCATTGCATTAGCATTAGG Reverse 0.5 AAAAGGGATAATCACTCGGGATA Probe 0.1 (TR)-TGCAAGATTTGGGAATCGGTGAAAA-(BHQ2) PhHV Forward 0.5 GGGCGAATCACAGATTGAATC Reverse 0.5 GCGGTTCCAAACGTACCAA Probe 0.1 (YY)-TTTTTATGTGTCCGCCACCATCTGGATC-(EDQ) 2 115 Dynamics of S. aureus in patients and the hospital environment
RkJQdWJsaXNoZXIy MTk4NDMw