Table 2. Continued. Homoplasy-based association analysis pyseer Genomic position mutation Counts ACGT Min changes CI crosstab AF pvalue Fisher FDR Gene name Genomic position mutation AF filterpvalue lrtpvalue 1946016 A>G 58:0:91:0 23 0.043 17:5:17:43 5.85E-01 1.03E-04 0.041 ugd 1946016* A>G* 0.402 5.02E-02 4.92E-01 1946067 G>T 0:0:65:84 22 0.045 18:4:20:40 5.37E-01 1.25E-04 0.05 non-coding region 1946067 G>T 0.537 9.58E-05 2.26E-01 1946072 T>A 84:0:0:65 22 0.045 18:4:20:40 5.37E-01 1.25E-04 0.05 non-coding region 1946072 T>A 0.537 9.58E-05 2.26E-01 1952745 A>G 131:0:40:0 28 0.036 9:13:52:8 2.56E-01 7.67E-05 0.037 hisD 1952745 G>A 0.732 6.54E-05 7.96E-03 2051214 T>A 137:0:0:34 19 0.053 11:11:5:55 8.05E-01 1.00E-04 0.041 unnamed 2051211* CACT>TACA 0.659 3.92E-03 4.87E-01 2051220 T>A 137:0:0:34 19 0.053 11:11:5:55 8.05E-01 1.00E-04 0.041 unnamed 2051220* T>A 0.793 4.79E-06 5.72E-02 2057518 A>G 111:0:60:0 19 0.053 7:15:49:11 3.17E-01 3.89E-05 0.036 dcm 2057506* ATGTTTCCCTGCGCAGCGAGT > CTGCTATCCGGCACAACGTATT 0.0122 9.66E-02 1.00E+00 2068593 G>A 45:0:123:0 17 0.059 9:13:52:8 2.56E-01 7.67E-05 0.037 fliM 2068593 G>A 0.256 2.60E-05 1.28E-01 4470140 C>T 0:147:0:24 17 0.059 7:15:51:9 2.93E-01 8.35E-06 0.034 ampC promoter 4470140 C>T 0.293 2.74E-06 5.42E-03 *pyseer identified multiple mutation variants, affecting the outcome, only the position with the highest allele frequency (AF) is reported which overlaps the result of the homoplasy-based association analysis. Sequences in the pyseer mutation of the pyseer outcome that are bold are the corresponding position with the tested genomic position. crosstab: R/other:R/mutation:S/other:S/mutation. AF: allele frequency, CI: Consistency Index, FDR: false discovery rate, mu: mutation, lrt: Likelihood ratio test. 7
RkJQdWJsaXNoZXIy MTk4NDMw