243 Unfolded Protein Response in PLN R14del Cardiomyopathy 9 CRISPR-Cas9 genome editing. Genome editing was performed in hiPSCs to either correct or introduce the PLN R14del mutation in hiPSCs by CRISPR-Cas9-mediated homologydirected repair (HDR) as described38. Briefly, the gRNA with the highest specificity score (gRNA: TTGAGGCATTTCAATGGTTG) was cloned into pSpCas9(BB)-2A-GFP (PX458; a gift from Feng Zhang; Addgene plasmid #48138). The PX458 vector (0.5 μg) and single-stranded oligodeoxynucleotide donor template (ssODN, 4.0 μg) were co-transfected in hiPSCs using 10 μL Lipofectamine Stemfect (Thermo Fisher Scientific). Twenty-four hours after transfection, the cells were dissociated with 1X TrypLE Express (Thermo Fisher Scientific) and GFP+ cells were sorted by FACS. Single-cell colonies were screened by PCR (PLN_Fw: AGGAGAGAAAGAGAGACAGACA; PLN_Rv: TCACTGTCACATATTAACCACCA) and Sanger sequencing to verify the insertion or correction of the PLN R14del mutation. The top eight ranking off-target sites predicted by the COSMID tool40 were also assessed (Tables II-V in the Supplement). The following sequence was used as HDR donor templates: >PLN R14del ssODN CTCGACCACTTAAAACTTCAGACTTCCTGTCCTGCTGGTATCATGGAGAAAGTCCAATACCTCACTCGCTCAGCTATAAGAGCATCAACCATTGAAATGCCTCAACAAGCACGTCAAAAGCTAC >PLN WT ssODN CTCGACCACTTAAAACTTCAGACTTCCTGTCCTGCTGGTATCATGGAGAAAGTCCAATACCTCACTCGCTCAGCTATAAGAAGAGCATCAACCATTGAAATGCCTCAACAAGCACGTCAAAAGC The primers and ssODNs were synthesized by Integrated DNA Technologies (IDT). Single-Cell RNA-seq library construction and sequencing. At 45 days after differentiation, cells were dissociated by incubation with 10x TrypLE solution for 10 min at 37 oC. Cells were filtered through a 40 µm cell strainer (BD Falcon), centrifuged at 100g for 3 min, and resuspended in PBS supplemented with 0.1% BSA. Single-cell encapsulation, cDNA generation, and preamplification as well as library preparation were performed using the Chromium Single Cell 3′ v2 reagent kit according to the instruction manual. Briefly, about 5,000 cells per sample were encapsulated into microdroplets and the barcoded complementary DNAs (cDNAs) were combined and amplified for library preparation according to the manufacturer’s protocol (10x genomics). Libraries were sequenced on the NextSeq 500 sequencing system with a target of 40000 to 50000 reads per cell (Illumina). Processing and analysis of scRNA-seq data. The raw FASTQ files were processed with the Cellranger software v1.3.0 (10x Genomics) for demultiplexing, mapping to the hg19, and quality control. The absolute unique molecular identifier (UMI) counts were quantified per gene per cell to generate a gene-barcode matrix for each sample. These sparse matrices were
RkJQdWJsaXNoZXIy MTk4NDMw