64 Chapter 3 KDAC inhibitor and LPS treatments Alveolar-like macrophages were seeded at a cell density of 300,000 cells/well in 12-wells plates with 1 mL medium/well, prior to incubation with the KDAC inhibitors. After culturing for 72 hours, they were either treated with 10 ng/mL lipopolysaccharide (LPS, Escherichia coli, serotype 0111:B4, Sigma-Aldrich; Merck, Darmstadt, Germany) for the last 4 hours of the experiment, with KDAC inhibitors for the last 20 hours, or with the combination of the two. KDAC inhibitors were dissolved in dimethyl sulfoxide (DMSO). MS275 (also known as Entinostat, Axon Medchem, Reston, Virginia, United States) and RGFP966 (Selleckchem, Houston, Texas, United States) were used at a concentration of 1µM. Treated cells were subsequently used for different analyses as depicted in Figure 1 and described below. Cytokine analysis by enzyme-linked immune-sorbent assay (ELISA) Cell culture medium was collected, centrifuged, and supernatants were analyzed for TNF-a and IL-10 by ELISA (both from R&D Systems, Minneapolis, MN, respectively DY410-05 and DY417-05), according to the manufacturer’s instructions. Gene expression analysis by reverse transcription quantitative polymerase chain reaction (RT-qPCR) Messenger RNA was isolated from cells using Maxwell® LEV Simply RNA Cells/Tissue kit (Promega, Madison, Wisconsin, US). A NanoDrop® ND1000 Spectrophotometer (Thermo Scientific) was used to measure total mRNA concentration in samples. cDNA synthesis from mRNA was performed using a Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) kit (Promega, Madison, Wisconsin, USA) in a Mastercycler® Gradient (Eppendorf, Hamburg, Germany) programmed for 10 minutes at 20°C, 30 minutes at 42°C, 12 minutes at 20°C, 5 minutes at 99°C, and 5 minutes at 20°C. Transforming growth factor beta (TGFβ; F: AGGGCTACCATGCCAACTTC, R: GTTGGACAACTGCTCCACCT), Suppressor Of Cytokine Signaling 3 (SOCS3; F: CCTTTGACAAGCGGACTCTC, R: GCCAGCATAAAAACCCTTCA ) genes were quantified using quantitative real-time PCR (RT qPCR) from the synthesized cDNA, using SensiMixTM SYBR® Green (Bioline, London, UK) in a 7900HT Real-Time PCR sequence detection system (Applied Biosystems, Waltham, Massachussets, US). PCR analysis consisted of 45 cycles of 10 min at 95°C, 15 seconds at 95°C, and 25 seconds at 60°C (repeated for 40 times) followed by a dissociation stage of 95°C for 15 seconds, 60°C for 15 seconds, and 95°C for 15 seconds. Output data were analyzed using SDS 2.4 software (Applied Biosystems) and ΔCt values were calculated after β-actin normalization. Two to the power of -ΔCt (2-ΔCt) was used as a final value for plotting and group comparisons.
RkJQdWJsaXNoZXIy MTk4NDMw