Chapter 6 108 (qPCR) was performed on an iCycler real-time PCR machine with SYBR green supermix. (Bio-Rad Laboratories, Hercules, CA), and Bio-Rad CFX Maestro software was used for normalised gene expression calculations. (Bio-Rad Laboratories). Table 1. Primer sequences Name Symbol mRNA sequence Forward primer Reverse primer Transmembrane protein 14A (human) TMEM14A NM_014051.3 TTTGGTTATGCAGCCCTCGT ATAGCCGGCCAAACATCCAA Glyceraldehyde-3phosphate dehydrogenase (human) GAPDH NM_002046 TGGTCACCAGGGCTGCTT AGCTTCCCGTTCTCAGCCTT Hypoxanthine-guanine phosphoribosyltransferase 1 (human) HPRT1 NM_000194.2 TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT Transmembrane protein 14A (rat) Tmem14a NM_014051.4 GGCCACCATAATGGGTGTGA CAGCAGCAGGACAAGTCTCA Hypoxanthine-guanine phosphoribosyltransferase 1 (rat) Hprt1 NM_012583.2 GGCTATAAGTTCTTTGCTGACCTG AACTTTTATGTCCCCCGTTGA Human material Anonymised tissue from renal biopsies from patients with various proteinuric renal diseases was collected from a previously described archive, including 20 patients with IgA nephropathy, 20 patients with lupus nephritis class III or IV, 10 patients with minimal change disease (MCD), and 13 patients with diabetes nephropathy (DN) at the department of pathology, Leiden University Medical Center.(93) Tissue of 10 kidneys that were unsuitable for transplantation and tumor-free renal resection material of 10 patients with a tumor elsewhere in the material were collected and used as a control group. All material was obtained, anonymised and handled according to institutional guidelines, Good Research Practice, and the Code of conduct for responsible use. Immunohistochemistry A commercially available polyclonal goat anti-TMEM14A antibody (Santa Cruz Biotech, sc-248899, Dallas, TX) was used for immunohistochemical staining of TMEM14A on human and rat material. In zebrafish material, the quality of staining was insufficient for reliable assessment. Immortalized podocytes that were confluent for 2 weeks were transferred to small glasses in a 24 wells plate. After 24 hours incubation immunohistochemistry was performed. Podocytes were washed in PBS and fixated using – 20 °C methanol. The glasses were then
RkJQdWJsaXNoZXIy MTk4NDMw