2 Cystinosis (ctns) zebrafish mutant shows pronephric glomerular and tubular dysfunction 41 were dissolved in physiological saline. ctns‒/‒ and wt zebrafish larvae (N=43 and 45, respectively) were anesthetized using 80 µg/ml tricaine methanesulfonate, injected with 2 nl of the 5% FITC-inulin in the sinus venosus at 96 hpf using the FemtoJet microinjector. Images were taken immediately after injection using the fluorescent microscope Leica MZ10F (Leica Microsystems, Wetzlar, Germany) and then larvae were transferred to 70 µl of water and incubated in the dark. Exactly after 4 hours tracked separately for each larva a second image was obtained by the fluorescent microscope using the exact same setting as the first image. Larvae not showing clear fluorescence in the vascular system immediately after injection were discarded. The fluorescence intensities over the caudal artery were evaluated using ImageJ software. Three mean intensity values for each larva were obtained over the somites 14, 15 and 16 at zero and four hours. The percentage of fluorescence intensity decline after 4 hours was evaluated for each somite and the average was taken for each larva. Two independent experiments were performed. RNA isolation and quantitative real-time PCR ctns‒/‒ and wt zebrafish larvae were homogenized at 3 dpf and 6 dpf. Total RNA was isolated from 30-80 whole larvae of each genotype at each time point using the TRIzol® reagent (Invitrogen, Waltham, MA, USA). Total RNA was eluted in 30-80 µl of nuclease-free water and stored at −80°C until further use. cDNA was synthesized from 1 µg of total RNA with the SuperScript® III RT kit (Invitrogen). qPCR reactions were carried out for zebrafish lrp2a gene (transcript ENSDART00000167243, Fw: GAACACACCAAATGCCAGTC, Rv: GAGAGGTACAGGTAATGGGC) using SYBR green with ROX in the StepOnePlus RT-PCR system (Applied Biosystems). Gene expression levels were normalized to the reference zebrafish gene eef1a1l1 (eukaryotic translation elongation factor 1 alpha 1, like 1, transcript: ENSDART00000023156, Fw: CTTCTCAGGCTGACTGTGC, Rv: CCGCTAGCATTACCCTCC), and then compared with wt larvae. Results were derived from at least 5 individually obtained RNA extracts for each genotype and presented as mean fold expression ± SD. Megalin staining Five dpf ctns‒/‒ and wt zebrafish larvae were fixed using 4% PFA overnight at 4°C, then washed with PBS 3x5 min before incubation with absolute methanol at -20°C for 20 min. Larvae were then mounted in cryosectioning moulds (4 larvae per each block), frozen on dried ice and sectioned using a Leica CM3050 S cryotome. Slides were stained for rabbit anti-megalin antibody (1:100, kindly provided by Michele Marino, University of Pisa, Italy) overnight at 4°C then for 3 hours at room temperature with Alexa-488
RkJQdWJsaXNoZXIy MTk4NDMw