15502-m-pleumeekers

NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, USA) at 260/280 nm. Next, complementary DNA (cDNA) was synthesized using the RevertAid TM First Strand cDNA Synthesis Kit (Fermentas GmbH, Leon-Rot, Germany) according to manufacturer’s instructions. Finally, PCR analysis was accomplished with a Bio-Rad CFX96 Real-Time PCR Detection System using TaqMan ® Universal PCR Master Mix (Applied Biosystems) or qPCR TM Mastermix Plus for SYBTR ® Green I (Eurogentec). Gene expression of collagen type II ( COL2A1 , Forward: GGCAATAGCAGGTTCACGTACA; Reverse: CGATAACAGTCTTGCCCCACTT), SRY (sex determining region Y)-box 9 ( SOX9, Forward: CAACGCCGAGCTCAGCA; Reverse: TCCACGAAGGGCCGC) and aggrecan ( ACAN, Forward: TCGAGGACAGCGAGGCC, Reverse: TCGAGGGTGTAGCGTGTAGAGA) was evaluated. Glyceraldehyde-3-phosphate dehydrogenase ( GAPDH, Forward: ATGGGGAAGGTGAAGGTCG; Reverse: TAAAAGCAGCCCTGGTGACC), Beta-2-Microglobulin ( B2M, Forward: TGCTCGCGCTACTCTCTCTTT; Reverse: TCTGCTGGATGACGTGAGTAAAC) and hypoxanthine phosphoribosyltransferase 1 ( HPRT1, Forward: TATGGACAGGACTGAACGTCTTG; Reverse: CACACAGAGGGCTACAATGTG), were used to determine a best-housekeeping-gene-index (BHKi) [211], which was used as reference for the expression of the genes of interest. The relative gene expression was calculated by the 2 -ΔCT formula. Statistics The mean and standard deviation (SD) of the variables of interest were calculated using MS Excel 2013 and PASW Statistics 21.0 (SPSS Inc. Chicago, USA) for 3 independent bovine donors per cartilage type, with 6 samples per donor. For statistical evaluation, a mixed linear model was used followed by a Bonferroni's post-hoc comparisons test. Treatment and cartilage type were defined as fixed factors in the model, while donor was considered as a random factor. Linear regression analysis was performed to evaluate the relationship between amount of matrix components and biomechanical properties after decellularization. For analysis, the mechanical properties (i.e. σ max , t 1/2 and Eeq) were defined as the dependent variables and matrix components (i.e. sGAG, collagen and elastin content) as independent variables. Differences in gene expression of the BMSCs seeded on decellularized cartilage scaffolds were determined by Mann-Whitney U-tests with the genes of interest (i.e. SOX9 , COL2A1 and ACAN ) set as test variables. Differences between human decellularized and untreated cartilage samples for 1 donor in 6-fold, were determined by Mann-Whitney U-tests as well with the biochemical parameters (i.e. DNA, sGAG, collagen and elastin contents) as test variable. Differences were considered statistically significant for p <0.05. 136 CHAPTER 7