15502-m-pleumeekers
TaqMan® Universal PCR Mastermix (Applied Biosystems) or qPCR Mastermix Plus for SYBR Green (Eurogentec, Nederland BV, Maastricht, the Netherlands) according to the manufacturers’ guidelines and using an ABIPRISM® 7000 with SDS software version 1.7 (Applied Biosystems, Nieuwerkerk a/d IJssel, the Netherlands). Amplification efficiencies for all assays were between 90-110%. Relative gene expressions of triplicate samples of each donor were calculated by means of the 2 -ΔCT formula. Primers and probes GAPDH Fw: ATGGGGAAGGTGAAGGTCG Rev: TAAAAGCAGCCCTGGTGACC Fam-CGCCCAATACGACCAAATCCGTTGAC HPRT1 Fw: TATGGACAGGACTGAACGTCTTG Rev: CACACAGAGGGCTACAATGTG Fam-CGCCCAATACGACCAAATCCGTTGAC ACAN Fw: TCGAGGACAGCGAGGCC Rev: TCGAGGGTGTAGCGTGTAGAGA Fam-ATGGAACACGATGCCTTTCACCACGA COL2A1 Fw: GGCAATAGCAGGTTCACGTACA Rev: CGATAACAGTCTTGCCCCACTT Fam-CCGGTATGTTTCGTGCAGCCATCCT COL10 Fw: CAAGGCACCATCTCCAGGAA Rev: AAAGGGTATTTGTGGCAGCATATT Fam-TCCAGCACGCAGAATCCATCTGA ALP Fw: GACCCTTGACCCCCACAAT Rev: GCTCGACTGCATGTCCCCT Fam-TGGACTACCTATTGGGTCTCTTCGAGCCA MMP13 Fw: AAGGAGCATGGCGACTTCT Rev: TGGCCCAGGAGGAAAAGC Fam-CCCTCTGGCCTGCGGCTCA Table 1. Sequences of primers and probes for qRT-PCR. Biochemical evaluation of the extracellular matrix Sample preparation At room temperature, alginate beads and discs were dissolved in 55 mM sodium citrate and 20 mM EDTA in 150 mM NaCl. All samples were then digested overnight at 60 o C with papain buffer to a final concentration of 250 μg/mL papain (0.2 M NaH2PO4, 0.01 M EDTA, pH 6.0 and freshly added 250 μg/mL papain, and 5 mM L-cystein), and later subjected to biochemical analyses to determine the DNA, glycosaminoglycan, and hydroxyproline contents. DNA content The amount of DNA measured in each papain-digested sample was determined by Ethidium bromide (GibcoBR1), using calf thymus DNA as a standard. Samples were analyzed with a 65 CARTILAGE-FORMING CAPACITY OF SEVERAL CELL SOURCES 4
Made with FlippingBook
RkJQdWJsaXNoZXIy MTk4NDMw