15502-m-pleumeekers

Primers and probes Human specific genes hsGAPDH Fw: AGCTCACTGGCATGGCCTTC Rev: CGCCTGCTTCACCACCTTCT hsACAN Fw: CAGCCACCACCTACAAACGCAG Rev: CTGGGTGGGATGCACGTCAGC hsCOL2A1 Fw: ACGAGGCCTGACAGGTCCCA Rev: GCCCAGCAAATCCCGCTGGT Bovine specific genes bsGAPDH Fw: GTCAACGGATTTGGTCGTATTGGG Rev: TGCCATGGGTGGAATCATATTGG bsACAN Fw: GGACACTCCTTGCAATTTGAGAA Rev: CAGGGCATTGATCTCGTATCG COL2A1 Fw: GGCAATAGCAGGTTCACGTACA Rev: CGATAACAGTCTTGCCCCACTT Table 2. Sequences of primers for qRT-PCR. GAPDH = GlycerAldehyde 3-Phosphate DeHydrogenase ; ACAN = Aggrecan ; COL2A1 = Collagen type 2 ; hs = human-specific ; bs = bovine-specific. Statistical analysis All data were analyzed with PSAW statistics 20.0 (SPSS inc. Chicago, USA). For in vitro alginate co-cultures, the mean and standard deviation represents at least three independent donors per cell source performed in triplicate. For statistical evaluation, a mixed linear model was used followed by a Bonferroni's post-hoc comparisons test. Condition and time point were defined as fixed factors in the model. Donor and sample number were treated as random factors. For in vivo alginate co-cultures, the mean and standard deviation represents at least three independent donors per cell source performed in duplicate. For the evaluation of the cellular communication pathways between MSCs and ACs, the mean and standard deviation represents one donor per cell source performed in sextuple. For statistical evaluation, the Kruskal-Wallis followed by the Mann-Whitney-U tests was used followed by a Bonferroni's post-hoc comparisons test. For all tests, values of p <0.05 were considered statistically significant. 93 AMSCs OR BMSCs FULFILL A TROPHIC ROLE IN CO-CULTURE 5